The sequencing reaction is one of the most amazing techniques I’ve seen. Most of the time a molecular biologist gets very little tangible feedback about what is going on: You spend your day mixing up microliter amounts of clear liquids.
However, on the left you see what your film looks like after sequencing. This film has been exposed by radioactively labelled DNA. The DNA is separated by length on the vertical axis, with the longest pieces at the top. Each lane marks a different nucleic acid. You read from top to bottom — thus this sequence of DNA is ggcttcgaaggggactaacaaaggg….
How does the sequencing reaction work? Well, it is similar to PCR — with a few very clever twists. Nucleic acids, which are the building blocks of DNA, can be thought of as really tiny Lego blocks. They have chemically reactive atoms that connect up to other nucleic acids — much like Legos plug into each other. Chemists have invented a new, artificial kind of nucleic acid called a “dideoxy nucleic acid”. Dideoxy nucleic acids are defective legos — they don’t have the bumps on top for another lego to plug into.
The sequencing reaction is very similar to PCR. The DNA polymerase is used to make copies of template DNA out of free nucleic acids. But in sequencing, there are four separate test tubes with almost identical reactions. Each test tube has a little bit of one of the four dideoxy nucleic acids : ddG, ddA, ddT or ddC. In the illustration above, I show the reaction containing ddG. Once in a while as the DNA polymerase is making copies of the template, it will use a ddG instead of a regular G. Since the ddG has no “sticky” end on top (brown arrow), that piece of DNA is prematurely truncated and cannot be extended any more. Furthermore, the length of the truncated DNA will precisely coincide with the position of the G in the DNA sequence.
After the four reactions are finished, the length of the DNA strands in each test tube is measured using electrophoresis. The result is a picture much like the one at the left. Maybe I’ll talk about electrophoresis in a future post.
2 replies on “How do they sequence a gene Part 2: Sequencing”
This is very interesting and complicated, so I want to print it out. Unfortunately, I can’t print the illustrations. Is there a way to do that?
Thank you for all this great information!
If you are using “Safari” you can print the illustration by control-clicking (right click if you have a three button mouse) on the illustration and choose “Print”.
I’m not sure why the illustrations don’t print when you print the page.
In “Internet Explorer” it appears that the illustrations print correctly; however, the sidebar isn’t placed correctly (it is at the bottom). But that’s not such a big deal.