Evolution Friday : DNA

The mitochondria is a small organelle found in all Eukaryotic organisms. Eukaryotes include all multicellular living things, such as trees, squid, sponges and people. They also include some single celled organisms like yeast, but not bacteria. One interesting feature of mitochondria is that they have their own genome made of DNA. It is possible to see the single, circular chromosome of the mitochondria under a microscope, and simple molecular techniques can be used to duplicate and analyze the mitochondrial DNA.



The National Institute of Health (NIH) has a division called the National Center for Biotechnology Information. They provide a lot of free services to facilitate research in the natural biological sciences. For one thing, they catalog DNA sequences from all living things as they are discovered. They also provide an analysis tooll called “BLAST” that lets you compare an input sequence to their entire database of sequences.



For today’s entry, I used the NCBI “nucleotide” search to download the entire mitochondrial sequence for the mouse. Here is the first seventy nucleotides of that sequence:

GTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAAATGCTTAGATGGATAATTTTATCCCATAAACACA

To a human, that doesn’t mean much in its current form. However, it is possible to use the BLAST tool to find all other sequences that match the mouse mitochondrial sequence. I did a crude search so that I didn’t bog down NIH’s computers. Even a quick and dirty, crude search provides overwhelming support for this discussion.



The first hit I retrieved was the sequence for “Rattus norvegicus mitochondrial genome”. The rat is a closely related species to the mouse, so this isn’t surprising. Here is a comparison of sixty of the nucleotides between the mouse and the rat:

Score = 7868 bits (4092), Expect = 0.0
Identities = 7491/9142 (81%), Gaps = 297/9142 (3%)
Strand = Plus / Plus
Query: 4909  taagtacaataaccctacccctagccccccaactaattatc-tagaagtttaggatatac 4967
|||||||  |||||||||| ||  || |||||||||| | | ||||||||||||||||||
Sbjct: 4886  taagtaccctaaccctaccgctttcctcccaactaatca-catagaagtttaggatatac 4944

I find it amazing that two species are able to faithfully duplicate the DNA molecule year after year, from generation to generation, and only develop such small changes. This is due in part to the fact that most changes would be fatal to the organism; only in a few places are changes going to provide benefit or be inconsequential.



The next sequence to match the mouse mitochondrial genome is the mitochondrial genome from Acinonyx jubatus, which you might recognize by its common name: Cheetah. Here is a peak at part of that comparison:

Score = 3798 bits (1975), Expect = 0.0
Identities = 5322/6920 (76%), Gaps = 384/6920 (5%)
Strand = Plus / Plus
Query: 5019  taaggactgtaag-acttcatcct-acatctattgaatgcaaatcaattgctttaattaa 5076
||||||||| ||| || | || || ||||| ||||| ||||||||||   ||||||||||
Sbjct: 5895  taaggactgcaagaacct-at-ctcacatcaattgactgcaaatcaaacactttaattaa 5952

The Cheetah is more distantly related to the mouse than the rat is. The DNA supports this notion: The cheetah and the mouse share 76% identical bases, whereas the rat and the mouse shared 81%. That may not seem like very high numbers to some of you — until you start to think about the odds. If the Cheetah and the mouse had been invented simultaneously the chances that their genome would be this similar than the NCBI computer can calculate (after a probability gets below 1 in 10,000,…(with one hundred zeros)…0,000 it just gives up and calls it ZERO).



Moving down the list reveals more distantly related species. There is Parascalops breweri, the hairy-tailed mole and Saimiri sciureus, the South American squirrel monkey. How about the Common Marmoset (Callithrix jacchus). It is not surprising that all mammals have mitochondrial DNA sequences that are similar; this evidence is consistent with the theory of evolution. All mammals share a common ancestor. Over time as the decendants diverged into separate species, the mitochondrial DNA picked up random changes. You would expect more distantly related species to have even more changes than you see within the mammals.



And sure enough, this is the case. Drosophila melanogaster, the fruit fly has mitochondria.

Score =  683 bits (355), Expect = 0.0
Identities = 1057/1397 (75%), Gaps = 58/1397 (4%)
Strand = Plus / Plus
Query: 5345 tgattattctcaaccaatcacaaagatatcggaaccctata-tctactatttggagcctg 5403
|||||||| || || ||||| |||||||| |||||  |||| | || | |||||||| ||
Sbjct: 1080 tgattattttctacaaatcataaagatattggaactttatatttta-tttttggagcttg 1138

The matching sequence shown here is for one part of the mitochondrial DNA called the “cytochrome c oxidase I gene”. Just for fun, I searched the database again using that sequence as the input query. Here is another way to compare a large number of sequences (the most similar species are near the top of the list).:

1_18238  1      tgattattctcaaccaatcacaaagatatcggaaccctatatctactatttggagcctg 59
50302071 5345   ........................................................... 5403
34555991 5343   ......................................c...........c........ 5401
34221823 168561 ............................................g.....c........ 168619
3150275  5344   ......................................c...........c..g..... 5402
51980679 1            ................................c...........c........ 53
54654337 6238       .............c..t...........t.....t.................... 6292
44894095 5335   ....................t...........c........ct..........t..... 5393
38602501 5379       .............c........c.....c....................t..... 5433
4239858  16     .................c..t.....c........a.................       68
57014054 5363   .....g.....t.....c...........t..c...........t.............. 5421
22137340 3      ...................................                         37
414126   5798       .............c........c.....c.........t..........t..... 5852
34393057 16     .................c..............t..t..g..........g...t..... 74
14582815 5363   ..........................c........tt....c...t.......t..... 5421
30314638 16     .................c..............t..t..g..........g...t..... 74
12484073 16     ..........................c........tt....c...t.......t..... 74
23306916 5460   .....t..........................c........c...g.t.....t..... 5518
4239866  16     ..........................c........tt....c...t.......t..... 74
38602445 5390       ......................c..t..c.........t..........t..... 5444
38602543 5383   ..............a..c...........t.....t..............          5432
4894501  6719       .............c.......................                   6755
25005957 5474   .....c........t.................c.........t..g.......       5526
25005593 6989       ..........a.....t.....c........a.................       7037
16041651 5409   ..........................c.....c........                   5449
38603494 5527   .....t....................c.....c.....t......g.......       5579
21425525 5347       ..........a.....t...........c.........t..........       5395
14588633 5527   .....t....................c.....c.....t......g.......       5579
14588619 5527   .....t....................c.....c.....t......g.......       5579
4887659  6484   ...........t..............c.....t...........                6527
56713965 5349   ........t........c..............c.....t..c..t........t..... 5407
13676803 5394       ..........t.....t........t..c...........t........t..... 5448
56398532 5321       ..........t.....t...........t..t......t..........c..... 5375
15430509 5509   .....t...........c....................t...t..a.c..c........ 5567

NCBI also provides a “taxonomy” report view which is simply amazing. Of the first one hundred hits in its database for the mouse mitochondrial cytochrome oxidase C DNA sequence, it pulled out organisms from all kinds of coelomates. (Coelomates are animals that have a gut — so most multicellular animals but not, for example, sponges.)
What is simply amazing about this report is how it coincides exactly with animal taxonomy. Keep in mind that taxonomy was originaly developed with no knowledge of DNA! But here, with a simply 59 DNA base query to the database, the DNA itself reconstructs the relationship between the mouse and (in order as you go down the table) other kinds of mice, rats, cows, sheep, whales, hippos, primates, birds, amphibians, reptiles, fish and ending with a cricket.



I can understand how someone might question evolution prior to the discovery of DNA. But when presented with such phenomenal data as this…. it simply becomes rediculous. I suppose a creationist may argue that this is just the way God created life. I don’t want to argue with other people’s religious beliefs, but it seems to me that if God created life, then we have overwhelming evidence that evolution is the process God chose.


Taxonomy Report

Coelomata ………………………………….   100 hits   55 orgs [root; cellular organisms; Eukaryota; Fungi/Metazoa group; Metazoa; Eumetazoa; Bilateria]

. Deuterostomia …………………………….    99 hits   54 orgs

. . Euteleostomi ……………………………    98 hits   53 orgs [Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi]

. . . Tetrapoda …………………………….    83 hits   39 orgs [Sarcopterygii]

. . . . Amniota …………………………….    81 hits   37 orgs

. . . . . Theria ……………………………    63 hits   26 orgs [Mammalia]

. . . . . . Eutheria ………………………..    61 hits   24 orgs

. . . . . . . Murinae ……………………….    28 hits    5 orgs [Rodentia; Sciurognathi; Muridae]

. . . . . . . . Mus …………………………    22 hits    3 orgs

. . . . . . . . . Mus musculus ……………….    22 hits    3 orgs

. . . . . . . . . . Mus musculus molossinus ……     1 hits    1 orgs

. . . . . . . . . . Mus musculus domesticus ……     1 hits    1 orgs

. . . . . . . . Rattus ………………………     6 hits    2 orgs

. . . . . . . . . Rattus norvegicus …………..     5 hits    1 orgs

. . . . . . . . . Rattus rattus ………………     1 hits    1 orgs

. . . . . . . Cetartiodactyla ………………..    24 hits   12 orgs

. . . . . . . . Pecora ………………………    17 hits    5 orgs [Ruminantia]

. . . . . . . . . Bovidae ……………………    15 hits    4 orgs

. . . . . . . . . . Bovinae ………………….    13 hits    3 orgs

. . . . . . . . . . . Bos ……………………    12 hits    2 orgs

. . . . . . . . . . . . Bos grunniens …………     1 hits    1 orgs

. . . . . . . . . . . . Bos taurus ……………    11 hits    1 orgs

. . . . . . . . . . . Bubalus bubalis …………     1 hits    1 orgs [Bubalus]

. . . . . . . . . . Ovis aries ……………….     2 hits    1 orgs [Caprinae; Ovis]

. . . . . . . . . Cervus nippon yesoensis ……..     2 hits    1 orgs [Cervidae; Cervinae; Cervus; Cervus nippon]

. . . . . . . . Cetacea ……………………..     6 hits    6 orgs

. . . . . . . . . Odontoceti …………………     2 hits    2 orgs

. . . . . . . . . . Berardius bairdii …………     1 hits    1 orgs [Ziphiidae; Berardius]

. . . . . . . . . . Pontoporia blainvillei …….     1 hits    1 orgs [Pontoporiidae; Pontoporia]

. . . . . . . . . Mysticeti ………………….     4 hits    4 orgs

. . . . . . . . . . Balaenoptera ……………..     2 hits    2 orgs [Balaenopteridae]

. . . . . . . . . . . Balaenoptera musculus ……     1 hits    1 orgs

. . . . . . . . . . . Balaenoptera acutorostrata .     1 hits    1 orgs

. . . . . . . . . . Eschrichtius robustus ……..     1 hits    1 orgs [Eschrichtiidae; Eschrichtius]

. . . . . . . . . . Balaena mysticetus ………..     1 hits    1 orgs [Balaenidae; Balaena]

. . . . . . . . Hippopotamus amphibius ………..     1 hits    1 orgs [Hippopotamidae; Hippopotamus]

. . . . . . . Primates ………………………     4 hits    2 orgs

. . . . . . . . Ateles geoffroyi ……………..     1 hits    1 orgs [Platyrrhini; Cebidae; Atelinae; Ateles]

. . . . . . . . Tarsius bancanus ……………..     3 hits    1 orgs [Tarsii; Tarsiidae; Tarsius]

. . . . . . . Herpestes javanicus …………….     1 hits    1 orgs [Carnivora; Fissipedia; Herpestidae; Herpestinae; Herpestes]

. . . . . . . Tamandua tetradactyla …………..     1 hits    1 orgs [Edentata; Myrmecophagidae; Tamandua]

. . . . . . . Pipistrellus abramus ……………     1 hits    1 orgs [Chiroptera; Microchiroptera; Vespertilionidae; Pipistrellus]

. . . . . . . Chrysochloris asiatica ………….     1 hits    1 orgs [Insectivora; Chrysochloridae; Chrysochloris]

. . . . . . . Tupaia belangeri ……………….     1 hits    1 orgs [Scandentia; Tupaiidae; Tupaia]

. . . . . . Peramelidae ……………………..     2 hits    2 orgs [Metatheria; Peramelemorphia]

. . . . . . . Isoodon macrourus ………………     1 hits    1 orgs [Isoodon]

. . . . . . . Macrotis lagotis ……………….     1 hits    1 orgs [Macrotis]

. . . . . Sauria ……………………………    18 hits   11 orgs [Sauropsida]

. . . . . . Neognathae ………………………    17 hits   10 orgs [Archosauria; Aves]

. . . . . . . Passeriformes ………………….    10 hits    5 orgs

. . . . . . . . Vidua chalybeata ……………..     1 hits    1 orgs [Estrildidae; Viduinae; Vidua]

. . . . . . . . Cnemophilus macgregorii ……….     1 hits    1 orgs [Corvoidea; Corvidae; Corvinae; Cnemophilus]

. . . . . . . . Basileuterus …………………     8 hits    3 orgs [Passeroidea; Fringillidae; Emberizinae]

. . . . . . . . . Basileuterus leucoblepharus ….     1 hits    1 orgs

. . . . . . . . . Basileuterus rivularis ………     4 hits    1 orgs

. . . . . . . . . Basileuterus fulvicauda ……..     3 hits    1 orgs

. . . . . . . Buteo buteo ……………………     1 hits    1 orgs [Falconiformes; Accipitridae; Accipitrinae; Buteo]

. . . . . . . Aythya americana ……………….     1 hits    1 orgs [Anseriformes; Anatidae; Aythya]

. . . . . . . Bubo virginianus ……………….     1 hits    1 orgs [Strigiformes; Strigidae; Bubo]

. . . . . . . Opisthocomus hoazin …………….     3 hits    1 orgs [Opisthocomiformes; Opisthocomidae; Opisthocomus]

. . . . . . . Arenaria interpres ……………..     1 hits    1 orgs [Charadriiformes; Scolopacidae; Arenaria]

. . . . . . Dinodon semicarinatus …………….     1 hits    1 orgs [Lepidosauria; Squamata; Scleroglossa; Serpentes; Colubroidea; Colubridae; Colubrinae; Dinodon]

. . . . Batrachia …………………………..     2 hits    2 orgs [Amphibia]

. . . . . Xenopus laevis …………………….     1 hits    1 orgs [Anura; Mesobatrachia; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus]

. . . . . Plethodon cinereus …………………     1 hits    1 orgs [Caudata; Salamandroidea; Plethodontidae; Plethodontinae; Plethodontini; Plethodon]

. . . Teleostei …………………………….    15 hits   14 orgs [Actinopterygii; Actinopteri; Neopterygii]

. . . . Neoteleostei ………………………..    14 hits   13 orgs [Elopocephala; Clupeocephala; Euteleostei; Neognathi]

. . . . . Holacanthopterygii …………………    13 hits   12 orgs [Eurypterygii; Ctenosquamata; Acanthomorpha; Euacanthomorpha]

. . . . . . Percomorpha ……………………..    11 hits   10 orgs [Acanthopterygii; Euacanthopterygii]

. . . . . . . Takifugu rubripes ………………     1 hits    1 orgs [Tetraodontiformes; Tetraodontoidei; Tetradontoidea; Tetraodontidae; Takifugu]

. . . . . . . Smegmamorpha …………………..     3 hits    3 orgs

. . . . . . . . Hypoptychus dybowskii …………     1 hits    1 orgs [Gasterosteiformes; Gasterosteoidei; Hypoptychidae; Hypoptychus]

. . . . . . . . Atherinomorpha ……………….     2 hits    2 orgs

. . . . . . . . . Gambusia affinis ……………     1 hits    1 orgs [Cyprinodontiformes; Cyprinodontoidei; Poeciliidae; Gambusia]

. . . . . . . . . Oryzias latipes …………….     1 hits    1 orgs [Beloniformes; Adrianichthyoidei; Adrianichthyidae; Oryziinae; Oryzias]

. . . . . . . Perciformes ……………………     6 hits    5 orgs

. . . . . . . . Carangidae …………………..     5 hits    4 orgs [Carangoidei]

. . . . . . . . . Trachurus ………………….     3 hits    2 orgs

. . . . . . . . . . Trachurus trachurus ……….     1 hits    1 orgs

. . . . . . . . . . Trachurus japonicus ……….     2 hits    1 orgs

. . . . . . . . . Caranx melampygus …………..     1 hits    1 orgs [Caranx]

. . . . . . . . . Carangoides armatus …………     1 hits    1 orgs [Carangoides]

. . . . . . . . Pterocaesio tile ……………..     1 hits    1 orgs [Percoidei; Lutjanidae; Caesioninae; Pterocaesio]

. . . . . . . Satyrichthys amiscus ……………     1 hits    1 orgs [Scorpaeniformes; Platycephaloidei; Peristediidae; Satyrichthys]

. . . . . . Paracanthopterygii ……………….     2 hits    2 orgs

. . . . . . . Bregmaceros nectabanus ………….     1 hits    1 orgs [Gadiformes; Bregmacerotidae; Bregmaceros]

. . . . . . . Melanocetus murrayi …………….     1 hits    1 orgs [Lophiiformes; Ceratioidei; Ceratioidea; Melanocetidae; Melanocetus]

. . . . . Ijimaia dofleini …………………..     1 hits    1 orgs [Stenopterygii; Ateleopodiformes; Ateleopodidae; Ijimaia]

. . . . Osteoglossum bicirrhosum ……………..     1 hits    1 orgs [Osteoglossomorpha; Osteoglossiformes; Osteoglossoidei; Osteoglossidae; Osteoglossum]

. . Meridiastra nigranota ……………………     1 hits    1 orgs [Echinodermata; Eleutherozoa; Asterozoa; Asteroidea; Valvatacea; Valvatida; Asterinidae; Meridiastra]

. Gryllotalpa orientalis …………………….     1 hits    1 orgs [Protostomia; Panarthropoda; Arthropoda; Mandibulata; Pancrustacea; Hexapoda; Insecta; Dicondylia; Pterygota; Neoptera; Orthopteroidea; Orthoptera; Ensifera; Grylloidea; Gryllotalpidae; Gryllotalpinae; Gryllotalpa]