Category: Uncategorized

Jesse and I stopped by Lake Johanna on our way to work this morning. The fog was visually stunning:

Fog forms over bodies of water when the atmospheric temperature drops below the water temperature. The vapor pressure of the warm water is greater than the vapor pressure of water vapor in the air. Thus there is a movement of water into the air, which immediately condenses as it mixes and gets cold. Sun “burns off” fog by raising the temperature of the air. As the air temperature increases it’s vapor pressure also increases — which means that it can hold more water.

Well, if you haven’t tried Mountain Dew Pitch Black, please don’t on my account. It is a disgusting grape flavor. But there is one cool thing about it: It has blue foam. This is kind of interesting because the soda itself appears to be black. One can’t just let strange things like this abide untested.
If you look closely at the drink, it is not actually black — it is a dark purple. However, this is clearly a different hue than the fizzing bubbles. What gives? Your’s truly investigates!
My first hypothesis is that the dye used in the beverage is sensitive to pH, and also that the bubbles in the beverage (which are in close proximity to the off gassing CO₂) may be at a different pH than the rest of the beverage. I know that carbon dioxide is a weak acid, but I’m only guessing that the water in the foam is a different pH. To test this hypothesis, I poured a small amount of Mountain Dew Pitch Black into two clear glass containers — one with some baking soda ( a base ) and one with vinegar ( an acid ). The color of the liquid remained the same in both. This shoots down my first hypothesis.
However, when I mixed the two together, the vinegar and baking soda reacted most pleasantly. And the foam turned blue, too…
Next, I hypothesized that there might be two separate dyes in the drink — one of them blue. Somehow the act of foaming up separates these two ingredients. Or, it could be that the blue dye is in much greater concentration, so that when it is diluted in the foam it still appears blue when the other dye no longer is effective. To test this hypothesis, we used paper chromatography. We placed a thin line of soda on a paper towel, and then put a few ice cubes next to the line. With the help of a few drops of water from a wet hand once in a while, the water melted off the ice cubes and wicked through the paper towel. As the water moved through the paper, the dye molecules were dragged along with it. But due to their different molecular weight and affinity for paper, they moved at different rates. The result was a separate band of color for each dye in the soda.

Furthermore, I discovered on The mountain dew website that sure enough, it contains two dyes: Blue 1 and Red 40. With the help of the National Library of Medicine’s Household Products Index, I was able to locate the molecular structures of the two dyes in the Chemical Information Database. Here they are:

FD&C Blue 1 (left) and FD&C Red 40 (right)
There are a few simple things that can be noted by looking at the structures. First, Blue 1 is a bigger molecule. Bigger molecules tend to diffuse more slowly. Interestingly, the blue strip on my paper chromatography experiment moved faster than the red stripe — so the red dye although smaller must interact more strongly with paper.
So why is the foam blue? My hypothesis that the dyes are getting separated in the foam seems highly improbable — purifying mixtures is a very hard thing to do. Try desalinating water, or filtering out a dye sometime. I’m pretty confident that the foam appears blue simply because the blue dye is in the soda at a higher concentration, so that when diluted you see mostly the blue color. The reason the hue can change during dilution is only if the blue dye is over saturated enough so that it remains blue long after the red dye has been diluted away.
We know from experience that soda pop foam is diluted — Coke has creamy white foam even though the drink is caramel colored. Regular mountain dew foam is barely a butter yellow color even though the drink is bright lemon yellow.
I’m waiting for the chance to test this hypothesis, by performing a serial dilution of the beverage. I think that the color should change to blue if you mix the right amount of water with it. Stay tuned.

---

(Later…) I just had another idea. It might be possible that the blue dye is actually preferentially associated with the foam. I’m thinking of soap as an example. Soap is a long molecule that has different hydrophobicity at each end. One end dissolves very well in water (like sugar or salt) — this end is hydrophillic (water loving). The other end is very oily and would rather be out of the water — that end is hydrophobic (water hating). The result is that the oily end of soap molecules surround greasy dirt and allow water to wash them away. Another side effect of soap is soap bubbles — which are tiny molecular sandwiches with the oily parts of the soap molecules sticking into the air. It never occurred to me before, but soap bubbles may have a higher concentration of soap in them than the rest of the solution.
So, if the blue dye in the Mountain Dew is a soapy molecule (soapier than the red), then it might preferentially stay in bubbles because the oily part of the molecule likes to stick in the air pockets. I can think of two more experiments to test this hypothesis. First of all, we could try to harvest the blue foam off the soda,then let the bubbles go away and compare the color of that liquid with the original. If the liquid is bluer, then we have proof that there was molecular separation.
The second experiment is to add some dish detergent to the Mountain Dew. The dish detergent is most likely a much better soap than the blue dye. It might fill up all the space in the bubbles, and it will also surround the oily parts of the dye — so it might cause the foam to no longer be blue. I’m not really sure this will work, because the soap will also cause there to be a lot more bubbles. That might nullify the first effects.
One other observation supports this latest hypothesis. But FD&C Red 1 is a flat, rigid mostly oily molecule with two water loving sulfates on either end. This probably isn’t a very good soap because the oily part is surrounded by the water loving part (remember soaps need to be polar to work well). FD&C Blue 40, on the other hand has three water loving sulfates, two of which are on floppy molecular connections that allow them to swivel around to the same side. That allows Blue 40 to have an oily side and a water loving side — just the recipie for soap. That oily side will like to associate with the surface of the water — which foam has a *lot* of.

Today the Earth and Mars have moved into an arrangement called a “Solar Conjunction”. This is similar to an eclipse: The Sun is positioned between the Earth and Mars.

The arrangement of the inner planets as of Sept 9

The Earth is the blue circle, and Mars is in red.

The solar conjunction means that the Mars Rovers need to operate without human assistance for two to three weeks. Radio transmissions can’t be sent through the Sun. The rovers will be parked taking spectrograph readings of rocks and dust, and observing how the winds affect a depression in the soil.

The sequencing reaction is one of the most amazing techniques I’ve seen. Most of the time a molecular biologist gets very little tangible feedback about what is going on: You spend your day mixing up microliter amounts of clear liquids.

However, on the left you see what your film looks like after sequencing. This film has been exposed by radioactively labelled DNA. The DNA is separated by length on the vertical axis, with the longest pieces at the top. Each lane marks a different nucleic acid. You read from top to bottom — thus this sequence of DNA is ggcttcgaaggggactaacaaaggg….
How does the sequencing reaction work? Well, it is similar to PCR — with a few very clever twists. Nucleic acids, which are the building blocks of DNA, can be thought of as really tiny Lego blocks. They have chemically reactive atoms that connect up to other nucleic acids — much like Legos plug into each other. Chemists have invented a new, artificial kind of nucleic acid called a “dideoxy nucleic acid”. Dideoxy nucleic acids are defective legos — they don’t have the bumps on top for another lego to plug into.

The sequencing reaction is very similar to PCR. The DNA polymerase is used to make copies of template DNA out of free nucleic acids. But in sequencing, there are four separate test tubes with almost identical reactions. Each test tube has a little bit of one of the four dideoxy nucleic acids : ddG, ddA, ddT or ddC. In the illustration above, I show the reaction containing ddG. Once in a while as the DNA polymerase is making copies of the template, it will use a ddG instead of a regular G. Since the ddG has no “sticky” end on top (brown arrow), that piece of DNA is prematurely truncated and cannot be extended any more. Furthermore, the length of the truncated DNA will precisely coincide with the position of the G in the DNA sequence.
After the four reactions are finished, the length of the DNA strands in each test tube is measured using electrophoresis. The result is a picture much like the one at the left. Maybe I’ll talk about electrophoresis in a future post.

Becka sent me this link with dozens of science toys. They are made from common Home Despot or Rad Shack items. My favorites so far are the hydrogen bomb and the simplest steam engine. But you’ve got to admit that the morse code radio transmitter is awesome as well…

In response to my discussion about genetic testing, I’ve been asked, “How do they do that?” They do it by sequencing the DNA. In my multi-part answer to this question, I’ll begin with the first step of that process: PCR.
PCR stands for “Polymerase Chain Reaction”. That might be a bit of an exaggeration, as it sounds like molecular biology gone wild. It is actually a very controlled and fascinating technique — quite possibly the most significant innovation in molecular biology in the past twenty-five years.
But first, lets cover some of the principle features of DNA: it is double stranded, composed of a repeating molecular letters that are complimentary and the two strands run antiparallel to each other.
What am I talking about????
Well, as I’m sure you’ve heard, DNA is a double-helix. The double-helix made up of a repeating sequence of a class of molecule known as a nucleic acid. There are four kinds nucleic acids that make up the helix. They are abbreviated as A, T, G and C. Furthermore, the nucleic acids of one strand are complimentary to the molecules in the other strand: An A in one strand is paired with a T in the other strand, and a C in one is paired with a G in the other. The cells of your body read the sequence of nucleic acids much like you read a reference book: you go to the chapter and begin reading the letters from left to right. DNA has a “left to right” direction too (but they call it “five prime to three prime”). DNA is antiparallel because when one strand is going left to right (five prime to three prime), its complimentary strand is going right to left (three prime to five prime). I’ve illustrated this in the diagram: The bottom strand’s letters are upside down.
To begin a PCR reaction, you need two important ingredients: A small amount of template DNA and primers. Template DNA is extracted from the blood of the patient. Each blood cell has the patient’s complete genomic DNA in its nucleus. The primers are short, single-stranded DNA molecules that are manufactured using modern chemistry techniques. Primers are designed to be complimentary to the template DNA. Furthermore, there are two primers that mark where to begin and where to end the manufacturing of DNA through PCR.
Okay, now on to the reaction itself. Here is a diagram illustrating the steps of PCR:

PCR (right click/control click and choose “Zoom In” for more detail)
PCR has three steps: denaturing, annealing and extending.
In the first step, heat is applied to the template DNA to pull the two strands apart to create single stranded template DNA. This process is known as denaturing. Next, the sample is allowed to cool with an excess of primer DNA in the test tube. The primer DNA is perfectly complimentary to the ends of the template DNA, thus it forms short regions of double-stranded DNA with the template. This step is called annealing. Finally some DNA Polymerase is added along with all the necessary nucleic acids, and the remaining single-stranded section of DNA is converted to double stranded as the primer is extended with complimentary bases. From one molecule of DNA, two have been made.
The “chain reaction” occurs when this process is repeated over and over, resulting in first 2, then 4, 8, 16… 2ⁿ copies! Most people stop around 15-20 cycles, but some people who are very daring somtimes go up to 30 or even 40 cycles.
Thus from the small amount of DNA that was extracted from the patients blood, a large quantity has been “amplified” using PCR. The amplified DNA will be used in the sequencing reaction… stay tuned!

This week the Olympics used the same arena that the original Olympians were at thousands of years ago. I saw them doing the Shot Put. Which got me thinking, of course, what is the best angle to lob a heavy rock in order to get the most distance.
If we start with some simple assumptions we can tackle this problem with algebra. It’s always good to know some boundary conditions just to make sure you can validate your answer. So lets start with these assumptions: We’re launching from ground level on a perfectly level field and there is no air friction. Oh, and as soon as the shot put hits the ground it stops. I think we can all agree that given those conditions, a perfectly horizontal launch won’t go anywhere because it never leaves the ground. Likewise a perfectly vertical launch net any distance either because it will land right where it started. Finally, let’s just take an educated guess: It is going to be somewhere between horizontal and vertical — let’s say 45 degrees as a first approximation.
Now let’s tackle the Algebraic solution to this puzzle. First, I always draw a picture to help me keep track of what’s going on.
The free body diagram.
Here I’ve shown the path of the ball as an arc. The total time (indicated by the stopwatch on the right) is t seconds. The length of the throw is X meters. The initial velocity of the ball is V meters per second at some angle, A, above horizontal. We’ll consider two parts of the velocity: The horizontal speed (Vx) and the initial vertical speed (Vy).
Here is the equation we need to solve this: d = vt + ½at2. We’ll also need to know the acceleration of gravity, G.
Well, the time the ball stays in the air is a function of the vertical component of the throw. So using the above equation we know v is actually Vy. The acceleration, a, is simply G. Finally, the ball is at ground level when the distance travelled is zero. Thus we want to solve:

0 = Vyt - ½Gt2
which has two solutions : t = 0 and t = 2 V_y / G . Hang on, we are making progress!
Using our original equation again, we can see how far the ball has traveled in that time:
X = Vxt
X = 2 VxVy / G
Now we simply use a little trig to relate V_x and V_y to V and A.
Vx = V cos(A)
Vy = V sin(A)
Thus our solution can be shown as this, in terms of V, A and G:
X = 2 V2 cos(A) sin(A) / G
The interesting thing about this result is that it shows that the distance a ball will travel is proportional to the square of how fast you throw it. This means that it is actually easier to differentiate how fast two atheletes can throw a ball based on how far the ball travels than if you were to measure the speed directly. Also, this makes sense in terms of energy, since we know that kinetic energy is proportional to the square of speed.
Moving on with the algebra… We can assume:
sin(2x) = 2 sin(x)cos(x)
That’s some trig I dug up on on the internet. Which gives us.
X = V2 sin(2A) / G
So what it all boils down to is finding the maxima of sin(2A). You need calculus — just a little tiny bit — to do this. What you do is look for a spot on the curve where it’s flat. It gets a little hairy, so I’ll just show you how to set it up and then solve it for you:
dX/dA = 0 = 2 V2 cos(2A)
Which basically boils down to the angle where cos(2A) = 0. The simplest answer is: 45°.
The problem really gets interesting when you factor in the height of the shot put upon throw (since the ball is several feet of the ground when the athelete releases it). Just how much this matters is left as an exercise for the reader. 🙂

Science and technology are responsible for the most dramatic shifts in world culture that our species has ever seen. Thanks to our understanding and application of scientific topics, the human species is able to communicate, travel and work like no other time in history. The last century is rife with monumental consequences of scientific discovery ranging from the atom bomb, to the green revolution to the human genome project. Science impacts every aspect of our lives.
And yet there is very little clear understanding of how science really works. Popular media glosses over scientific details. Statistical analyses are carried to absurd conclusions. Movies will just make things up. The result is a world in which people see science as an impenetrably opaque shrine of doctrine instead of the open realm of debate and knowledge.
I usually rant and rave (my friends are often quoting my remark of, “That’s not science!”) but little else. As of today, I’m starting this blog as an outlet for my frustration. I intend to answer questions about science and to correct the blatant inaccuracies seen in the news or from the entertainment industry. Send me your questions! Let’s dig into the Science Fare!