hi from sanibel! 🙂
“We’re thinking of all you poor sucka’s back home,” quoth Tismo. He got crabs.
Category: Uncategorized
Zombies!
For all those Dungeons and Dragons fans who also love Macintosh Computers, I feel it is my duty to warn you about zombie processes that are running rampant through your operating system! Why, you ask, why do they exist? Their only purpose is to tell their parent process that they have died! Thus, the zombie process cannot be kill(1)ed, not even kill -9ed!!! The only way to get rid of a zombie is – gasp! – to kill(1) its parent! Does that seem harsh? — well, if the parent process would just wait(2) once in a while, it would pick up on those not-so-subtle SIGNALs (SIGCHLD — roughly translated from computerese means “Hey, ma, your kid is dead”). But no, our zombie’s parent is too busy to wait(2)… we’ll have no choice but to kill the unattentive parent. Then our zombie will be adopted by init, the parent of all lost processes. Init is always wait(2)ing to hear of the demise of its children (init is kind of a worry wart, I guess) So finally our zombie will be at rest.
The moral of the story : Zombies can’t be killed. They just want love, and if you stop and listen they will be at rest. If you see a zombie, and its parent isn’t listening to it, you can just go ahead and kill the parent.
I have to admit, sometimes your operating system will be overrun by zombies. Then you can’t start any more processes, not even kill(1). Basically at this point you are screwed. You can try sacrificing some healthy processes to free up a few PIDs, but ultimately you may just have to reboot.
Busy day…
we are busy this week at work, so not much time for writing. but i ran across these pictures i took recently and thought you might like to look at them.



What are the odds
Today we went to get our drivers licenses renewed. We saw an old friend there. We haven’t seen her in about eight years (since we moved away from Vermillion, SD).
So what are the chances of running into someone you know in a city the size of Minneapolis? To calculate the odds, you need two pieces of information: the number of people there are to see, and how many of them you see each day. There are three million people living in Minneapolis. How many people do I see each day? If I add up all the strangers I see in the Drivers licence place, and the coffee shop, and the grocery store, restaurant, post office, etc… I suppose I see 100 strangers each day.
Thus the probability that one of those strangers is Muriel is 100 in 3,000,000 or 1 in 30,000.
If you keep looking for her, after a year your odds are up to 365 / 30,000 — or about 1 in 80. Unfortunately, as you start to get to the point that you’ve seen a significant fraction of the people in the city, the chances that you’re seeing the same strangers over and over again increases (the basis for this is the “Bernoulli Distribution”). Nevertheless, I think it is safe to say that you’d be up to around a 1 in 25 chance that you’d have seen her once after four years. So we were pretty lucky to find her after only four years!
Or were we? After talking with her, it turns out that she’s worked only two blocks away from where I work the whole time.
Sigh.
My friend Adam is recovering from open heart surgery really well. Earlier I said he was six months old — that shows how time flies, because he really is nearly one! I wanted to share the good news with you, and point you at his mom’s blog about her son’s heart surgery as well as the pictures of the heart surgery recovery. So far it is a “heart-warming” (if you’ll forgive the pun) tale about modern medicine. Go Adam!
Evolution Friday : Fossil Horses
One of the oldest pieces of evidence supporting the theory of evolution is the fossil record. Fossils are the ancient bones (or other evidence) from life that are preserved in rock. The fossil record provides an astounding array of evidence that supports the theory of evolution. Through the study of fossils, an overwhelming body of evidence has accumulated depicting the progress of lifeforms on earth.
Because it is a bit much to tackle in one short essay, I’ll narrow my focus. I remember a neat exhibit I saw about eight years ago at a small museum in northern Nebraska. It is at the site of the Ashfall Fossil beds.

In the main lobby of this museum they have a display case showing foot bones from a variety of horse-like animals. Over the years there have been many many different kinds of horses. The modern horse (of genus equus) is the last from a diverse family ultimately descended from a common three-toed ancestors. Over time there has many different horse-like animals in wide variety of forms. All but one of the 27 genera that have existed are now extinct. That fact alone shows the creative but ruthless nature of evolution — that so many would come to exist, ultimately to dissappear and be replaced by another species.
One interesting thing about the ancestral species of horses is how their feet transformed from a three-toed structure into the modern horse’s hoof. These two forms are very different. It is hard to imagine how the one could gradually transform into the other. But evolution works on the principle of gradual change, with no intermediate form having a detrimental effect on the organism.
At first glance, this may seem to be a valid argument against evolution. Consider a more extreme, fictitious example: Why do you suppose that no animals have evolved jet engines? I believe it is because a jet engine is exceedingly complex. But not only that. Also because there is no conceivable benefit gained by most of a jet engine. A jet engine either works or else it doesn’t — and building 90% of a jet engine is an enormous burden on a struggling species. Thus you can’t invent a scenerio where gradual evolutionary pressure would result in a jet engine.
Contrast that with how animals do fly — by flapping wings. This process has some advantage even when the flight is limited. For example, the flying squirrel has relatively little adaptation (just a slightly modified rib cage and extra skin webbing their arms and legs) — and yet this enables the animal to move around a jungle better than a regular squirrel can. Given enough time and selective pressure, the flying squirrel might eventually evolve into an animal as adept at flying as a bat.
So how does the horse fit into this? The fossils from the Ashfall fossil beds show a variety of species of horses. The feet of those horses are structured from the same bones as both modern horses and the ancient three-toed ancestor. But they range in structure from very modern to very ancient in appearance. And the key point is — now that we can see them — it’s clear that all of them worked just fine.
A hole in his heart
I just got word that my friend, Adam age 6 months, has come out of surgery for Atrioventricular (AV) Canal Defect. This surgery involved cutting open part of his heart.
These two images compare normal and AV canal defect hearts.


In an AV heart, the piece of heart tissue called the Ventricular Septum that separates the left and right halves is missing. Surgery is used to rebuild this missing structure, and also to repair the tricuspid valves which are also misformed.
At first I thought that this defect was in some way related to the foramen ovale. The foramen ovale is a different kind of “hole in the heart”. It is present in the fetus, and serves to allow blood flowing through the heart to bypass the lungs. It is between the left and right atrium (not the ventrical is in Adam’s case). It’s needed because a fetus does not get its oxygen from the lungs — it gets it from the placenta via the umbilical cord. By bypassing the lungs, the fetus is able to redistribute the oxygenated blood more efficiently. At birth, the foramen ovale closes, causing blood flow to be sent to the lungs. If this fails to close, it can result in cyanotic heart disease, in which a newborn turns blue due to lack of oxygenated blood.
Here’s hoping to a speedy recovery for little Adam.
Ephemeris Calculator
JPL has a ephemeris calculator that will determine where celestial bodies can be found in the sky. This is useful if you’re trying to find how far away a certain planet or asteroid is.
You could use this to keep track of 2004 MN4, an asteroid which will come close to the earth In 2029. It will pass inside the Moon’s orbit, although it won’t hit either the moon or earth. It should be visible with the naked eye — if you live in Africa, Europe or parts of Asia that is. MN4 is about 1000 feet across and would be locally but not globally devastating if it hit the earth.
http://news.bbc.co.uk/2/hi/science/nature/4243805.stm
“…his definition of a biological species – an interbreeding population that cannot breed with other groups – is the most widely accepted one today.”
Evolution Friday : DNA
The mitochondria is a small organelle found in all Eukaryotic organisms. Eukaryotes include all multicellular living things, such as trees, squid, sponges and people. They also include some single celled organisms like yeast, but not bacteria. One interesting feature of mitochondria is that they have their own genome made of DNA. It is possible to see the single, circular chromosome of the mitochondria under a microscope, and simple molecular techniques can be used to duplicate and analyze the mitochondrial DNA.
The National Institute of Health (NIH) has a division called the National Center for Biotechnology Information. They provide a lot of free services to facilitate research in the natural biological sciences. For one thing, they catalog DNA sequences from all living things as they are discovered. They also provide an analysis tooll called “BLAST” that lets you compare an input sequence to their entire database of sequences.
For today’s entry, I used the NCBI “nucleotide” search to download the entire mitochondrial sequence for the mouse. Here is the first seventy nucleotides of that sequence:
GTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAAATGCTTAGATGGATAATTTTATCCCATAAACACA
To a human, that doesn’t mean much in its current form. However, it is possible to use the BLAST tool to find all other sequences that match the mouse mitochondrial sequence. I did a crude search so that I didn’t bog down NIH’s computers. Even a quick and dirty, crude search provides overwhelming support for this discussion.
The first hit I retrieved was the sequence for “Rattus norvegicus mitochondrial genome”. The rat is a closely related species to the mouse, so this isn’t surprising. Here is a comparison of sixty of the nucleotides between the mouse and the rat:
Score = 7868 bits (4092), Expect = 0.0 Identities = 7491/9142 (81%), Gaps = 297/9142 (3%) Strand = Plus / Plus Query: 4909 taagtacaataaccctacccctagccccccaactaattatc-tagaagtttaggatatac 4967 ||||||| |||||||||| || || |||||||||| | | |||||||||||||||||| Sbjct: 4886 taagtaccctaaccctaccgctttcctcccaactaatca-catagaagtttaggatatac 4944
I find it amazing that two species are able to faithfully duplicate the DNA molecule year after year, from generation to generation, and only develop such small changes. This is due in part to the fact that most changes would be fatal to the organism; only in a few places are changes going to provide benefit or be inconsequential.
The next sequence to match the mouse mitochondrial genome is the mitochondrial genome from Acinonyx jubatus, which you might recognize by its common name: Cheetah. Here is a peak at part of that comparison:
Score = 3798 bits (1975), Expect = 0.0 Identities = 5322/6920 (76%), Gaps = 384/6920 (5%) Strand = Plus / Plus Query: 5019 taaggactgtaag-acttcatcct-acatctattgaatgcaaatcaattgctttaattaa 5076 ||||||||| ||| || | || || ||||| ||||| |||||||||| |||||||||| Sbjct: 5895 taaggactgcaagaacct-at-ctcacatcaattgactgcaaatcaaacactttaattaa 5952
The Cheetah is more distantly related to the mouse than the rat is. The DNA supports this notion: The cheetah and the mouse share 76% identical bases, whereas the rat and the mouse shared 81%. That may not seem like very high numbers to some of you — until you start to think about the odds. If the Cheetah and the mouse had been invented simultaneously the chances that their genome would be this similar than the NCBI computer can calculate (after a probability gets below 1 in 10,000,…(with one hundred zeros)…0,000 it just gives up and calls it ZERO).
Moving down the list reveals more distantly related species. There is Parascalops breweri, the hairy-tailed mole and Saimiri sciureus, the South American squirrel monkey. How about the Common Marmoset (Callithrix jacchus). It is not surprising that all mammals have mitochondrial DNA sequences that are similar; this evidence is consistent with the theory of evolution. All mammals share a common ancestor. Over time as the decendants diverged into separate species, the mitochondrial DNA picked up random changes. You would expect more distantly related species to have even more changes than you see within the mammals.
And sure enough, this is the case. Drosophila melanogaster, the fruit fly has mitochondria.
Score = 683 bits (355), Expect = 0.0 Identities = 1057/1397 (75%), Gaps = 58/1397 (4%) Strand = Plus / Plus Query: 5345 tgattattctcaaccaatcacaaagatatcggaaccctata-tctactatttggagcctg 5403 |||||||| || || ||||| |||||||| ||||| |||| | || | |||||||| || Sbjct: 1080 tgattattttctacaaatcataaagatattggaactttatatttta-tttttggagcttg 1138
The matching sequence shown here is for one part of the mitochondrial DNA called the “cytochrome c oxidase I gene”. Just for fun, I searched the database again using that sequence as the input query. Here is another way to compare a large number of sequences (the most similar species are near the top of the list).:
1_18238 1 tgattattctcaaccaatcacaaagatatcggaaccctatatctactatttggagcctg 59 50302071 5345 ........................................................... 5403 34555991 5343 ......................................c...........c........ 5401 34221823 168561 ............................................g.....c........ 168619 3150275 5344 ......................................c...........c..g..... 5402 51980679 1 ................................c...........c........ 53 54654337 6238 .............c..t...........t.....t.................... 6292 44894095 5335 ....................t...........c........ct..........t..... 5393 38602501 5379 .............c........c.....c....................t..... 5433 4239858 16 .................c..t.....c........a................. 68 57014054 5363 .....g.....t.....c...........t..c...........t.............. 5421 22137340 3 ................................... 37 414126 5798 .............c........c.....c.........t..........t..... 5852 34393057 16 .................c..............t..t..g..........g...t..... 74 14582815 5363 ..........................c........tt....c...t.......t..... 5421 30314638 16 .................c..............t..t..g..........g...t..... 74 12484073 16 ..........................c........tt....c...t.......t..... 74 23306916 5460 .....t..........................c........c...g.t.....t..... 5518 4239866 16 ..........................c........tt....c...t.......t..... 74 38602445 5390 ......................c..t..c.........t..........t..... 5444 38602543 5383 ..............a..c...........t.....t.............. 5432 4894501 6719 .............c....................... 6755 25005957 5474 .....c........t.................c.........t..g....... 5526 25005593 6989 ..........a.....t.....c........a................. 7037 16041651 5409 ..........................c.....c........ 5449 38603494 5527 .....t....................c.....c.....t......g....... 5579 21425525 5347 ..........a.....t...........c.........t.......... 5395 14588633 5527 .....t....................c.....c.....t......g....... 5579 14588619 5527 .....t....................c.....c.....t......g....... 5579 4887659 6484 ...........t..............c.....t........... 6527 56713965 5349 ........t........c..............c.....t..c..t........t..... 5407 13676803 5394 ..........t.....t........t..c...........t........t..... 5448 56398532 5321 ..........t.....t...........t..t......t..........c..... 5375 15430509 5509 .....t...........c....................t...t..a.c..c........ 5567
NCBI also provides a “taxonomy” report view which is simply amazing. Of the first one hundred hits in its database for the mouse mitochondrial cytochrome oxidase C DNA sequence, it pulled out organisms from all kinds of coelomates. (Coelomates are animals that have a gut — so most multicellular animals but not, for example, sponges.)
What is simply amazing about this report is how it coincides exactly with animal taxonomy. Keep in mind that taxonomy was originaly developed with no knowledge of DNA! But here, with a simply 59 DNA base query to the database, the DNA itself reconstructs the relationship between the mouse and (in order as you go down the table) other kinds of mice, rats, cows, sheep, whales, hippos, primates, birds, amphibians, reptiles, fish and ending with a cricket.
I can understand how someone might question evolution prior to the discovery of DNA. But when presented with such phenomenal data as this…. it simply becomes rediculous. I suppose a creationist may argue that this is just the way God created life. I don’t want to argue with other people’s religious beliefs, but it seems to me that if God created life, then we have overwhelming evidence that evolution is the process God chose.
Taxonomy Report
Coelomata …………………………………. 100 hits 55 orgs [root; cellular organisms; Eukaryota; Fungi/Metazoa group; Metazoa; Eumetazoa; Bilateria]
. Deuterostomia ……………………………. 99 hits 54 orgs
. . Euteleostomi …………………………… 98 hits 53 orgs [Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi]
. . . Tetrapoda ……………………………. 83 hits 39 orgs [Sarcopterygii]
. . . . Amniota ……………………………. 81 hits 37 orgs
. . . . . Theria …………………………… 63 hits 26 orgs [Mammalia]
. . . . . . Eutheria ……………………….. 61 hits 24 orgs
. . . . . . . Murinae ………………………. 28 hits 5 orgs [Rodentia; Sciurognathi; Muridae]
. . . . . . . . Mus ………………………… 22 hits 3 orgs
. . . . . . . . . Mus musculus ………………. 22 hits 3 orgs
. . . . . . . . . . Mus musculus molossinus …… 1 hits 1 orgs
. . . . . . . . . . Mus musculus domesticus …… 1 hits 1 orgs
. . . . . . . . Rattus ……………………… 6 hits 2 orgs
. . . . . . . . . Rattus norvegicus ………….. 5 hits 1 orgs
. . . . . . . . . Rattus rattus ……………… 1 hits 1 orgs
. . . . . . . Cetartiodactyla ……………….. 24 hits 12 orgs
. . . . . . . . Pecora ……………………… 17 hits 5 orgs [Ruminantia]
. . . . . . . . . Bovidae …………………… 15 hits 4 orgs
. . . . . . . . . . Bovinae …………………. 13 hits 3 orgs
. . . . . . . . . . . Bos …………………… 12 hits 2 orgs
. . . . . . . . . . . . Bos grunniens ………… 1 hits 1 orgs
. . . . . . . . . . . . Bos taurus …………… 11 hits 1 orgs
. . . . . . . . . . . Bubalus bubalis ………… 1 hits 1 orgs [Bubalus]
. . . . . . . . . . Ovis aries ………………. 2 hits 1 orgs [Caprinae; Ovis]
. . . . . . . . . Cervus nippon yesoensis …….. 2 hits 1 orgs [Cervidae; Cervinae; Cervus; Cervus nippon]
. . . . . . . . Cetacea …………………….. 6 hits 6 orgs
. . . . . . . . . Odontoceti ………………… 2 hits 2 orgs
. . . . . . . . . . Berardius bairdii ………… 1 hits 1 orgs [Ziphiidae; Berardius]
. . . . . . . . . . Pontoporia blainvillei ……. 1 hits 1 orgs [Pontoporiidae; Pontoporia]
. . . . . . . . . Mysticeti …………………. 4 hits 4 orgs
. . . . . . . . . . Balaenoptera …………….. 2 hits 2 orgs [Balaenopteridae]
. . . . . . . . . . . Balaenoptera musculus …… 1 hits 1 orgs
. . . . . . . . . . . Balaenoptera acutorostrata . 1 hits 1 orgs
. . . . . . . . . . Eschrichtius robustus …….. 1 hits 1 orgs [Eschrichtiidae; Eschrichtius]
. . . . . . . . . . Balaena mysticetus ……….. 1 hits 1 orgs [Balaenidae; Balaena]
. . . . . . . . Hippopotamus amphibius ……….. 1 hits 1 orgs [Hippopotamidae; Hippopotamus]
. . . . . . . Primates ……………………… 4 hits 2 orgs
. . . . . . . . Ateles geoffroyi …………….. 1 hits 1 orgs [Platyrrhini; Cebidae; Atelinae; Ateles]
. . . . . . . . Tarsius bancanus …………….. 3 hits 1 orgs [Tarsii; Tarsiidae; Tarsius]
. . . . . . . Herpestes javanicus ……………. 1 hits 1 orgs [Carnivora; Fissipedia; Herpestidae; Herpestinae; Herpestes]
. . . . . . . Tamandua tetradactyla ………….. 1 hits 1 orgs [Edentata; Myrmecophagidae; Tamandua]
. . . . . . . Pipistrellus abramus …………… 1 hits 1 orgs [Chiroptera; Microchiroptera; Vespertilionidae; Pipistrellus]
. . . . . . . Chrysochloris asiatica …………. 1 hits 1 orgs [Insectivora; Chrysochloridae; Chrysochloris]
. . . . . . . Tupaia belangeri ………………. 1 hits 1 orgs [Scandentia; Tupaiidae; Tupaia]
. . . . . . Peramelidae …………………….. 2 hits 2 orgs [Metatheria; Peramelemorphia]
. . . . . . . Isoodon macrourus ……………… 1 hits 1 orgs [Isoodon]
. . . . . . . Macrotis lagotis ………………. 1 hits 1 orgs [Macrotis]
. . . . . Sauria …………………………… 18 hits 11 orgs [Sauropsida]
. . . . . . Neognathae ……………………… 17 hits 10 orgs [Archosauria; Aves]
. . . . . . . Passeriformes …………………. 10 hits 5 orgs
. . . . . . . . Vidua chalybeata …………….. 1 hits 1 orgs [Estrildidae; Viduinae; Vidua]
. . . . . . . . Cnemophilus macgregorii ………. 1 hits 1 orgs [Corvoidea; Corvidae; Corvinae; Cnemophilus]
. . . . . . . . Basileuterus ………………… 8 hits 3 orgs [Passeroidea; Fringillidae; Emberizinae]
. . . . . . . . . Basileuterus leucoblepharus …. 1 hits 1 orgs
. . . . . . . . . Basileuterus rivularis ……… 4 hits 1 orgs
. . . . . . . . . Basileuterus fulvicauda …….. 3 hits 1 orgs
. . . . . . . Buteo buteo …………………… 1 hits 1 orgs [Falconiformes; Accipitridae; Accipitrinae; Buteo]
. . . . . . . Aythya americana ………………. 1 hits 1 orgs [Anseriformes; Anatidae; Aythya]
. . . . . . . Bubo virginianus ………………. 1 hits 1 orgs [Strigiformes; Strigidae; Bubo]
. . . . . . . Opisthocomus hoazin ……………. 3 hits 1 orgs [Opisthocomiformes; Opisthocomidae; Opisthocomus]
. . . . . . . Arenaria interpres …………….. 1 hits 1 orgs [Charadriiformes; Scolopacidae; Arenaria]
. . . . . . Dinodon semicarinatus ……………. 1 hits 1 orgs [Lepidosauria; Squamata; Scleroglossa; Serpentes; Colubroidea; Colubridae; Colubrinae; Dinodon]
. . . . Batrachia ………………………….. 2 hits 2 orgs [Amphibia]
. . . . . Xenopus laevis ……………………. 1 hits 1 orgs [Anura; Mesobatrachia; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus]
. . . . . Plethodon cinereus ………………… 1 hits 1 orgs [Caudata; Salamandroidea; Plethodontidae; Plethodontinae; Plethodontini; Plethodon]
. . . Teleostei ……………………………. 15 hits 14 orgs [Actinopterygii; Actinopteri; Neopterygii]
. . . . Neoteleostei ……………………….. 14 hits 13 orgs [Elopocephala; Clupeocephala; Euteleostei; Neognathi]
. . . . . Holacanthopterygii ………………… 13 hits 12 orgs [Eurypterygii; Ctenosquamata; Acanthomorpha; Euacanthomorpha]
. . . . . . Percomorpha …………………….. 11 hits 10 orgs [Acanthopterygii; Euacanthopterygii]
. . . . . . . Takifugu rubripes ……………… 1 hits 1 orgs [Tetraodontiformes; Tetraodontoidei; Tetradontoidea; Tetraodontidae; Takifugu]
. . . . . . . Smegmamorpha ………………….. 3 hits 3 orgs
. . . . . . . . Hypoptychus dybowskii ………… 1 hits 1 orgs [Gasterosteiformes; Gasterosteoidei; Hypoptychidae; Hypoptychus]
. . . . . . . . Atherinomorpha ………………. 2 hits 2 orgs
. . . . . . . . . Gambusia affinis …………… 1 hits 1 orgs [Cyprinodontiformes; Cyprinodontoidei; Poeciliidae; Gambusia]
. . . . . . . . . Oryzias latipes ……………. 1 hits 1 orgs [Beloniformes; Adrianichthyoidei; Adrianichthyidae; Oryziinae; Oryzias]
. . . . . . . Perciformes …………………… 6 hits 5 orgs
. . . . . . . . Carangidae ………………….. 5 hits 4 orgs [Carangoidei]
. . . . . . . . . Trachurus …………………. 3 hits 2 orgs
. . . . . . . . . . Trachurus trachurus ………. 1 hits 1 orgs
. . . . . . . . . . Trachurus japonicus ………. 2 hits 1 orgs
. . . . . . . . . Caranx melampygus ………….. 1 hits 1 orgs [Caranx]
. . . . . . . . . Carangoides armatus ………… 1 hits 1 orgs [Carangoides]
. . . . . . . . Pterocaesio tile …………….. 1 hits 1 orgs [Percoidei; Lutjanidae; Caesioninae; Pterocaesio]
. . . . . . . Satyrichthys amiscus …………… 1 hits 1 orgs [Scorpaeniformes; Platycephaloidei; Peristediidae; Satyrichthys]
. . . . . . Paracanthopterygii ………………. 2 hits 2 orgs
. . . . . . . Bregmaceros nectabanus …………. 1 hits 1 orgs [Gadiformes; Bregmacerotidae; Bregmaceros]
. . . . . . . Melanocetus murrayi ……………. 1 hits 1 orgs [Lophiiformes; Ceratioidei; Ceratioidea; Melanocetidae; Melanocetus]
. . . . . Ijimaia dofleini ………………….. 1 hits 1 orgs [Stenopterygii; Ateleopodiformes; Ateleopodidae; Ijimaia]
. . . . Osteoglossum bicirrhosum …………….. 1 hits 1 orgs [Osteoglossomorpha; Osteoglossiformes; Osteoglossoidei; Osteoglossidae; Osteoglossum]
. . Meridiastra nigranota …………………… 1 hits 1 orgs [Echinodermata; Eleutherozoa; Asterozoa; Asteroidea; Valvatacea; Valvatida; Asterinidae; Meridiastra]
. Gryllotalpa orientalis ……………………. 1 hits 1 orgs [Protostomia; Panarthropoda; Arthropoda; Mandibulata; Pancrustacea; Hexapoda; Insecta; Dicondylia; Pterygota; Neoptera; Orthopteroidea; Orthoptera; Ensifera; Grylloidea; Gryllotalpidae; Gryllotalpinae; Gryllotalpa]
